Systemic steroidStudy Subjects

Six patients with asthma were enrolled (three men and three women; mean age, 28 years). Asthma was diagnosed according to the criteria of the American Thoracic society. All asthmatic patients were nonsmokers, and two of the asthmatic patients had atopy. None of the patients with asthma had complications from other lung disease, and they did not have a history suggesting systemic viral infections, tumors, or autoimmune diseases. Systemic steroid was not used in asthmatic patients during the previous 3 months.

Six healthy volunteers (two men and four women; mean age, 26 years) were enrolled from graduate students at the College of Medicine, Korea University, and served as control subjects. All control subjects were nonsmokers and had normal findings on chest radiography, normal airway reactivity, and normal pulmonary function test results; and they had no current respiratory symptoms, were nonatopic, and had no respiratory infections within the previous month. None were receiving any medications. Informed consents were obtained from each subject for their participation in the study, and the approval of the protocol was obtained by the Clinical Research Ethics Committee of Korea University Medical Center.

Processing of Samples

Twenty milliliters of blood were taken from each person and mixed with 20 mL of normal saline solution and 4 mL of density gradient medium (Ficoll-Paque, S.G. 1.077; Amersham Pharmacia Biotech; Upsala, Sweden). After centrifugation (1,200 revolutions per minute for 12 min without break), the mononucleated cell layer was separated and the CD3+ T-lymphocytes were independently purified from each blood sample by the methods of a T-cell-negative isolation procedure with using monoclonal antibody (Dynal; Dynal Biotech; Lake Success, NY). Twelve samples of T-lymphocytes from 12 persons were ready for the following processes.

2D-PAGE

CD3+ T-lymphocytes of each person were lysed with buffer (containing 7 mol/L urea/2 mol/L thiourea, 4% 3-[(3-cholamido-propyl)dimethylamino]-1-propanesulfonate, 40 mmol/L Tris hydrochloride, 100 mmol/L dithiothreitol, and 1 X protease inhibitor cocktail) [Roche Diagnostic Corporation; Indianapolis, IN]. The extracted protein concentration was determined by a modified Bradford protein assay (Bio-Rad; Richmond, CA).

proteomicsIsoelectric focusing was performed on 17-cm immobilized pH gradient strips (Bio-Rad), with a pI 3-10 linear gradient, on a isoelectric focusing cell (IPGphor; Bio-Rad). After the proteins were mixed with rehydration solution (8 mmol/L urea, 2% 3-[(3-cholamidopropyl)dimethylamino]-1-propane sulfonate, 50 mmol/L dithiothreitol, 0.5% immobilized pH gradient buffer pH 3-10, and a trace of bromophenol blue), this was followed by focusing for 1 h at 200 V, 1 h at 500 V, 1 h at 1,000 V, 1 h at 8,000 V subsequently at 8,000 to 64,000 V/h. The pH gradient strip (Immobiline Drystrip; Amersham Pharmacia Biotech) after isoelectric focusing was equilibrated with buffer (6 mmol/L urea, 50 mmol/L Tris, 30% glycerol, 2% sodium dodecyl sulfate, 1% dithiothreitol, and a trace of bromophenol blue) for 20 min, and then applied onto a 10% polyacrylamide gel (10 to 12 cm). The second-dimension separation was performed sequentially (Ettan DALTsix; Amersham Pharmacia Biotech). The separated spots were visualized by the silver-based staining technique. Six control samples and six asthma samples were analyzed individually in the 2D-PAGE technique.

The silver-stained two-dimensional gels were scanned on an image scanner (Powerlook 1100; UMAX; Taipai, Taiwan). Analyses of spot-intensity calibration, spot detection, background abstraction, and matching of approximately 12 2D-PAGEs were performed using software (ProteomWeaver; Definiens; Munich, Germany). All selected spots were present in all gels. The differentially expressed spots were analyzed with using Mann-Whitney U test (SPSS, version 10.0.05; SPSS; Chicago, IL). Correction for multiple comparisons was done according to the false discovery rate (FDR) method described by Benjamini et al using the FDRalgo software for Microsoft Windows made available to the public with a significance value of 0.05; p values larger than the FDR a value that was calculated using this software were considered statistically nonsignificant.

Identification of Protein Spots

Spots of interest were analyzed (Voyager 4307 MALDI-TOF-MS; Applied Biosystems; Foster City, CA). The proteins were identified with peptide mass fingerprinting data using a search program (MS-FIT).

Real-time Polymerase Chain Reaction

We performed real-time polymerase chain reaction (RT-PCR) for validation study about some identified proteins with using a Miniprep method (Qiagen; Valencia, CA). Primers were designed from the sequence of human phosphodiesterase 4C (PDE4C), glutathione S transferase-M3 (GST-M3), and thioredoxin-2 complementary DNAs that were published in Gene Bank. The nucleotide sequences of primers were as following (PDE4C, 5’AGAGTGGTACCAGAGCAAGA3′; GST-M3, 5’TCTATGGT-TCTCGGGTACTG3′; thioredoxin-2, 5’AGCTCTGTTCCCAC-TTTTCT3′).

Advertisements

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s